MEÓN de pelo estofado
   
  TillusCreations
  EL RAYO AZUL
 

EL RAYO AZUL

ERA NUESTRO PRIMER VIAJE A HAWAII GRACIAS A AQUEL NUMERO DE CIEGOS QUE APARECIÓ EN MI BOLSILLO EN FORMA DE TURULO (NI IDEA DE QUIEN SERÍA ESA NOCHE HABÍA SIDO CRIMINAL )LO UNICO QUE RECUERDO ES A UN NEGRO QUE LE ESCUPÍ SIN QUERER EN LA CARA Y ME SOLTÓ UN TORTAZO DEL QUE SALÓ UN RAYO AZUL, SI SEÑOR AZUL , SALIÓ EL 25784 , CINCO KILOS GUAU!!! LO PREIMERO QUE SE ME OCURRIÓ FUE INVITAR A MIS MELORES AMIGOS Y A MI CHICA A UN VIAJE A HAWAII, ya QUE PRONTO SE CELEBRARIA EL PIPELINE CONTEST ANUAL Y PARA ALLA FUIMOS, YA DE ENTRADA NOS PARARON EN EL AEROPUERTO, PUES COMO NO, TODA LA ROPA DE AARON OLIA A MARIA Y LO PERSEGUIAN TODOS LOS PERROS POLICIAS, TRAS CHOCARLE LA MANO A UN PIKOLETO CON UN BILLETE DE CIEN NOS DEJÓ CONTINUAR, YA EN FACTURACIÓN EL JAVI HABIA OLVIDADO EL BUGUI (FUERTE DESPISTE) Y LE DIJIMOS TOTAL SI NO TE VAS A METER PA QUE LO QUIERES, Y SEGUIMOS, VIKI TUVO QUE DEJAR ALLI INNUMERABLES BOTES DE CREMAS Y JABONES PUES LA NIÑA IVA CON SOBREPESO DE EQUIPAJE (YA SABES LAS MUJERES PA UNA SEMANA QUE VAN DE VIAJE SE LLEVAN COSAS PA UN AÑO DIOS), NADA SALIÓ EL AVIÓN Y NOS PUSIERON VARIAS PELICULAS DURANTE EL TRAYECTO (ATERRIZA COMO PUEDAS, UN REPOTAJE DEL 11S, Y ALGUNAS IMÁGENES DE GRANDES ACCIDENTES AEREOS, TODA UNA GOZADA), DE PRONTO A MEDIO VUELO, SE OYE UNA VOZ ESCANDALOSA DICIENDO "JAMAKALAKA, MINOCATOLO ATUNA" Y VEMOS A UN TIPO CON BARVA A LO BIL-LADEN CORRIENDO POR EL PASILLO CON ALGO EN LA MANO, ANTONIO CON CARA DE INFARTO LE METIÓ LA SANCADILLA, EL MORO CALLÓ Y SOBRE EL SE ABALANZARON VARIOS PASAJEROS Y DE PRONTO SE OYÓ UNA ESPLOSIÓN, TODO EL MUNDO ENTRE HISTERIA Y ACOJONO SE ECHÓ LAS MANOS A LA CABEZA, PERO CUAL FUE LA SORPRESA QUE EN VEZ DE OLER A QUEMADO OLÍA A MIERDA, EL POBRE MORO LO QUE LE PASABA ES QUE SE ESTABA CAGADO PUES LO QUE DECIA EN SU EXTRAÑO IDIOMA A VOCES ERA (YA TRADUCIDO), "DEJEN ME PASAR QUE ME ESTOY CAGANDO" POR LO VISTO SE HABÍA MANDADO UN PERRITO PICADO EN EL AEROPUERTO. QUEDABAN DOS HORAS DE VIAJE Y EL OLOR ERA INSOPORTABLE, INCLUSO HUBO UNA REACCÓN DE POTAS EN CADENA IMAGÍNATE QUE MAL RATO, LA AZAFATA ERA FEA. LLEGAMOS POR FIN AL AEROPUERTO HAWAIIANO, TODO GENIAL, YA SE VEÍA A TRAVÉS DE LAS CRISTALERAS EL CIELO AZUL Y LAS PALMERAS, FUIMOS A COGER LAS MALETAS (LE HABÍAN PERDIDO LA DE JAVI (QUE MALA SUERTE), FUIMOS A POR LA FURGONETA DE ALQUILER UNA CITROEN JAMPER TIPO FURGÓN GRANDE PERO SORPRES NOS VEMOS EN MEDIO DEL APARCAMIENTO UNA CITROEN JAMPY OHH NO LA MAS PEQUEÑA DE LA GAMA Y DE CARGA (EL ANTONIO SE HABIA EQUIVOCADO AL RESERVARLA DIOS CASI NI CABÍAMOS "SI QUIERS QUE ALGO SALGA BIEN HAZLO TU MISMO).

EL CAMPEONATO EMPEZABA HOY Y FUIMOS DIRECTAMENTE PA LA PLAYA, HABÍA UN AMBIENTE INMEJORABLE, TIAS CON VIKINIS Y SUS RELLENOS IMPRESIONANTES, TIEMPAZO Y UNOS MATROCOS(OLAS) QUE NOS DEJARON CON LOS EGGS EN LA GARGANTA. NO SE LE OCURRE OTRA COSA A CARLOS QUE TIRAR UNA CASCARA DE PLATANO POR LA VENTANA CON TAN MALA SUERTE QUE IMPACTÓ DIRECTAMENTE EN LA CARA DE SANNY GARCIA (EL MAS FEO DE LOS LOCALES), Y LO ÚNOCO QUE SE OYÓ FUE ACELERA , ACELERA QUE VIENE, TRAS DESPISTARLO APARCAMOS A LA ZORRINA TRAS UNAS PALMERAS, YA ERA LA HORA, EN LA PRIMERA MANGA ENTRABA TOBY EL POBRE NO LLEGÓ NI AL PICO LO TUVIERON QUE SACAR MEDIO AHOGADO, EN LA SEGUNDA IBA YO, EL MAR HABÍA CRECIDO, LOS LATIDOS DE MI CORAZÓN PARECÍAN TAMBORES, ESTABA COMO MEDIO PARALIZADO Y ME TEMBLABA EL PIÉ, NADA TIRÉ PA DENTRO, NO SE LES OCURRIÓ OTRA COSA A LOS DE LA ORGANIZACIÓN QUE PONER MUSICA DE PANTERA (ESA MEDIA DEMONIACA), ME DABA LA IMPRESIÓN DE QUE MI TIEMPO DE VIDA SE TERMINABA, PASÉ VARIOS ESPUMONES Y NO SE COMO HUYENDO DEL DEMOLEDOR PICO Y POR EL TREMENDO CORRIENTÓN QUE HABIA DEREPENTE ESTABA EN EL MISMO PICO (EL TERCER ARRECIFE DE LA TEMIDA PIPELINE) DIOS. VIENE UNA SERIE LA PRIMERA TENIA 5 METROS Y SE VEÍAN LAS DE DETRÁS ASOMANDO POR ENCIMA IMAGINATE, Y ME DIJE TILLO O COGES LA PRIMERA O NO VAS A PASEAR MAS A LOS POMBOS (MIS PERROS), Y LE MANDÉ PA ABAJO, ESTUBE BAJANDO COMO 10 SEGUNDOS Y LUEGO CUANDO VI QUE SE ESTABA QUEDANDO TODO SECO HICE UN MACRO BOTONTORN ME QUEDE CLAVADO EN LA PARED Y SENTÍ PASAR EL LABIO POR ENCIMA DE MI CABEZA COMO SU FUERA UN ESCUADRÓN DE AVIONES DE COMBATE, CAYÓ EL LABIO Y ME QUEDE EN LA PARTE MAS INTERIOR DE UN TUBO QUE NADIE HAYA ESTADO (NI MIKE), LA LUZ DESAPARECIÓ Y PUDE INCLUSO VER ALGUNOS CALAMARES Y AGUAVIVAS DE ESAS MEDIAS FLUORESCENTES (YA SABES COMO LAS DE LOS REPORTAJES DE LAS PROFUNDIDADES DEL OCEANO), EMPECÉ A VER MI VIDA PASAR POR MI MENTE A GRAN VELOCIDAD (NO VEÍA MAS QUE BORRACHERAS Y CACAS DE LOS POMBOS JODER) PERO DE PRONTO COMENCÉ A VER UN PUNTO DE LUZ AL FINAL DEL TUBO, NO SABIA SI ERA EL FAMOSO TUNEL QUE DICEN VES CUANDO LA PALMAS O SI SE TRATABA DE LA SALIDA DEL TREMENDO TUBO, Y DE PRONTO COMO SI FUERA A VELOCIDAD SUPERSONICA ME ATRAVEZÓ UN RAYO AZUL QUE ME VINO POR DETRÁS ,EL MISMO RAYO QUE VI CUANDO ME SOLTÓ EL TORTAZO AQUEL NEGO DE MARCHA ,Y SALÍ DE AQUEL HIPERMACRO TUBO CON UN SIFON CON LOS COLORES DEL ARCOIRIS, LO HABIA SACADO NO ME LO PODÍA CREER, FUI HACIA LA ORILLA CARGADO DE ADRENALINA CUANDO ME PERCATÉ DE QUE MIS BRAZOS SE HABIAN VUELTO DE COLOR NEGRO (¿?????????) Y OÍ LA VOZ DE VIKI DICIENDO VAMOS BOB VAMOS QUE HAY QUE PREPARAR EL CONCIERTO Concierto? Bob? PERO QUE ESTÁ HABLANDO ESTA LOCA Y PORQUÉ LLEVAVA UN PAÑUELO EN LA CABEZA Y ROPAS LARGAS, DE PRONTO VI A JAVI JITANO QUE TAMBIÉN ERA NEGRO Y LE DECIAN PITER PITER (ERA EL AUTENTICO PITER TOSH), CARLOS ERA EL DE ALFHA BLONDY Y AARON SE HABIA TAMBIEN CONVERTIDO EN EL CANTANTE DE ISRAEL VIVRATION, ENTOCES COMPRENDÍ (BOB?) BOB MARLEY CLARO SOY BBBBOOOOBBBBB MMMMMAAARRRRLLLEEEYYYYY

AARON CON UN PETA DESCOMUNAL EN LA MANO SE ACERCÓ A MI Y ME DIJO BOB ESTA ES LA GRAN NOCHE LA MAS ESPERADA HOY SE CRUZARÁN ESOS ASTROS QUE NOS DEVOLVERAN A NUESTRA TIERRA LEJOS DE BABILONIA, DEBE ESTAR TODO PREPARADO PARA EL GRAN CONCIERTO, YO HACIENDOME EL LOCO LE DIJE SI SI LO QUE TU DIGAS VOY A ECHARME ALGO, LA VIKI (QUE AHORA ERA UNA DE ESAS MUJERS DE LOS WAILERS YA SABES LAS DE LOS COROS) ME DIJO VAMOS A TU SESIÓN DE MASAJES QUE DEBES ESTAR RELAJADO PARA ESTA NOCHE Y YO DIJE OK OK, TRAS UN GRAN PAPEO Y MULTIPLES CARICIAS QUEDÉ DORMIDO , CUANDO DESPERTÉ PENSÉ JODER TIO QUE SUEÑO HE TENIDO, PERO ALGO ME PESABA EN LA CABEZA ,PENSÉ CHACHO DE ME ENGANCHÓ UNA ZARZA EN EL PELO, PERO NO, ERA EL PELUCO RASTA, GGGGGGUUUUUUUAAAAAUUUU ESTO SIGUE PA LANTE, YA SE OIA EL BULLICIO DE LA PEÑA HACIA EL CONCIERTO, ERA DENOCHE APARECIÓ AARON CON OTRO TRONKO PETARDO (Y ME DIJO A LAS 12 ES EL MOMENTO PREPÁRATE), YO ME ECHÉ UN CORTADITO Y TIRÉ PA LLI. EMPEZÓ EL CONCIERTO CON PITER TOSH DELEITÁNDONOS CON SU CLASICO LIGELIZA MARIHANA, LUEGO FUE EL TURNO PARA ALFHA BLONDY, HABIA UN AMBIENTE MÁGICO DE ALEGRIA Y BIENESTAR (MUY BUEN ROLLO), CONTINUÓ AARON DE ISRAEL VIVRATION CON SUS TEMAZOS EL CIELO SE FUE TORNANDO DE COLORES Y FINALMENTE ERA MI TURNO, SE ACERCABAN LAS 12 DE LA NOCHE, EL PUBLICO VIBRAVA, LA MARIA VOLAVA YO ME DESFASABA, Y CON EL NATURAL MISTIC OCURRIÓ, SE ALINEARON LOS PLANETAS Y CAYÓ EL RAYO AZUL SORE TODOS NOSOTROS, COMENZAMOS A LEVITAR LOS 300.000 RASTAS QUE HABIAN ALLI (LOS QUE QUEDABAN EN LA TIERRA) SOBRE UNAS ESPECIE DE NUVES Y COMENZÓ EL VIAJE ,ESAS NUVES NOS LLEVARÍAN A NUESTROS SITIOS NATURALES A NUESTRA TIERRA, Y A LA VEZ OTRAS NUVES ELVARON A LOS BABILONIOS(LOS AMERICANOS CHUNGOS) HACIA UN PLANETA APARTE, Y AL DESCENDER ESAS NUVES EL MUNDO HABÍA CAMBIADO YA NO EXISTÍA EL DINERO NI LA PROPIEDAD PRIVADA (EL MAL HABÍA SIDO DESTERRADO DE ESTE MUNDO), EN ESTE NUEVO MUNDO SE CAMBIBAN PAPAS POR HUEVOS, SE COMPARTIA, Y SE VIVIA FELIZ, NO EXISTIRÍA EL HAMBRE NI EL PODER, SERÍA EL MUNDO MAGICO DEL RAYO AZUL.

FIN JEJEJEJJEJEJEJEJEJ (NO HE FUMAO EH!!!)

tillusss 04/03/2008

 
  VISITAS 2 visitantes¡Aqui en esta página! NO COPIES NADA SIN PERMISO MIO O TE PARTO LAS PIERNAS  
 
=> ¿Desea una página web gratis? Pues, haz clic aquí! <=
PATRAÑA, cara hueVo, pelo cuca